sheena70 sheena70

01-01-2019
English

contestada

i bought the ---- from the sundry shop
a. dozen
b. loaf
c. bouquet
d. comb

Respuesta :

zjamieee zjamieee

01-01-2019

c. bouquet
A doesn't make sense

Answer Link

mary4228 mary4228

01-01-2019

I’m going to say a loaf

Answer Link

Otras preguntas

Which is NOT an energy type?

he uniform 110-kg beam is freely hinged about its upper end A and is initially at rest in the vertical position withθ= 0. Determine the initial angular accelera

The following order book exists for a particular stock. The last trade on the stock was at $58.34. Buy Orders Sell Orders Shares Price Shares Price 250 $58.33 2

a television and DVD player cost a total of 976. The cost of the television is three times the cost of the DVD player. Find the cost of each item

Explain how to use factoring to solve the equation: 2x^2 + 5x = 3..

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Match them to its definition. pls help

when the wheels of a bicycle rotate 30 times, the bicycle moves a distance of 175 feet. what is the rate?

Name one type or group of plants that have vascular tissue. A.ferns B.mosses

John is an agent for Peabody. John tells Wanda (a third party) of Peabody’s existence, but not its identity, therefore John is an agent for a(n) ______ principa