allisonerinsmiouqmf8 allisonerinsmiouqmf8

02-01-2019
Mathematics

contestada

!!!CALCULUS!!! 20 POINTS
Find the first term of the arithmetic sequence in which a_27=-1/2 and the common difference is 2.
103/2
-105/2
-103/2
111/2

Respuesta :

mikikiki mikikiki

02-01-2019

-1/2=a_1+26*2
-1/2=a_1+52
a_1= -1/2-52
a_1= (-1-104)/2
a_1= -105/2

Answer Link

Otras preguntas

Raul pays for three muffins with a $10 bill. The cashier then gives him $2.86 in change. What was the cost of one muffin?

in a recent semester at a local university 520 students enrolled in both general chemistry and calculus 1. Of these students 88 received an A in general chemist

HELP I need to ask an important question about this paragraph

Which phrases in the passage provide clues that trifling means "silliness" or "insignificance"? Check all that apply. "a toy" "in blood" "not permanent" "his fa

2. A tradition is something we do that is special and ____________ down through the generations. A. to passed B. is passed C. passing D. is passing

What is the image point of (4,4) after a translation right 4 units and down 5 units

What were citizens upset about in the Yazoo Land Fraud?

Simplify. 5² KWHGFPB'pagr

2. Which of the following answers best reflects the purpose of initial Spanish and Portuguese expeditions to the New world following the voyages of Columbus? A)

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'