jusufovicmirveta jusufovicmirveta

03-04-2020
History

contestada

The president can Vito or sign bill into law.What principal is reflected in this power?

Respuesta :

DavidA2316 DavidA2316

05-04-2020

Answer:

The Constitution explicitly assigns the president the power to sign or veto. I hope this help : )

Explanation:

Answer Link

Otras preguntas

drivers are required to signal a change of direction for at least:

What group began to dominate the south

why can wearing dark clothes at night be dangerous?

Line p has an equation of y=-8x+6. Line q, which is perpendicular to line p, includes the point (2,–2). What is the equation of line q?Write the equation in slo

Solve the formula 18x + 3y = 15 for y.

answer plzzzz im begging

Read the passage from the end of a narrative essay. When I talk about the experience now, I have mixed emotions. On the one hand, I’m envious of how simple life

About how deep into the ocean do the Sun’s rays reach? WILL MARK BRAINLIEST

someone help me out please im losing brain cells :D~ and im confused

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'