catianab93 catianab93

01-11-2016
Physics

contestada

If vector A ⃗ has components A x and A y and makes an angle θ with the +x axis, then

Respuesta :

01-11-2016

Then the tangent of angle-Θ is (Ay / Ax).

Answer Link

Otras preguntas

when the iron(III) oxide reacts with hydrochloric acid, iron (III) chloride and water are formed. How many gras of iron (III) chloride are formed from 10.0g of

Find the difference 9/4 - 4/3?

Apothem = Side = Radius = Perimeter = Area =

Tickets to a spring concert are $5.00 for students and $8.00 for adults. 250 tickets to the concert were sold for a total of $1550. How many tickets adult tic

C Wiederholung - Ergänze die Dativpronomen.dir /euch/ Ihm /ihnen /Ihnen/ Ihnen/ ihnen /ihr /ihr/mir/Mir/ uns1. A:Kannst du .................. helfen? Ich verste

Which literary technique does mark twain use to characterize huckleberry Finn?

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

are there integers that are not rational numbers

how do you work this problem 4x+1<9

A toy airplane climbs 30 vertical feet while traveling 50 feet horizontally. A toy helicopter climbs 20 feet while traveling 40 feet horizontally. Assuming a st