master59 master59

02-11-2021
English

contestada

Pharaphrase this sentence:
They took good store, of which every family had their portion

Respuesta :

mwilliams302 mwilliams302

02-11-2021

Answer: They took a portion of the good store, of which every family had.

Explanation:

Answer Link

Otras preguntas

Write the polynomial in standard form. then name the polynomial based on its degree and number of terms.2 – 11x2 – 8x + 6x2

accounting i know that when there's two panels its debit and credit but what is the third for what is each one

Carl earned $6.20 per hour and worked 6 1/2 hours per day. What is the best estimate of his earning for a five-day work week?

What physical properties must the substances in a mixture have to use filtration to seperate the substances?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip

Solve for x. Assume that lines which appear tangent are tangent.

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

Classify this triangle... sides 4 ,7, 10

Why did new technology revolutionize communications