mariacristo001 mariacristo001

03-01-2017
History

contestada

Why might the existence of the 2 alliances have actually helpt to encourage a massive war?

Respuesta :

samuelbtta samuelbtta

03-01-2017

more people involved would mean bigger war

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Jackie is reading a 252 page novel for her summer reading project. On Monday she reads 4/8 of the novel. On Tuesday she reads 28 pages, and on Wednesday she rea

What is the image point of (4,4) after a translation right 4 units and down 5 units

A) 22 B) 5 C) 12 D) 11

Describe the natural resources of Russia.

why does getting a bill passed require so many steps? Choose the best answersA. To make sure that every bill is thoroughly examined, and has the support of a l

Please help, thank you

How is mitochondrial DNA (mtDNA) typing used in forensic science?

temperature decreases most rapidly with depth at ___________ latitudes.

Your long distance service provider charges you $.06 per minute plus a monthly access fee of $4.95. For referring a friend, you receive a $10 service credit thi