lemusanaisabel370 lemusanaisabel370

02-03-2022
Chemistry

contestada

A wave has frequency of 50 waves per second (Hz) and a wavelength of 10 m. What is the speed of the wave?

Respuesta :

NezukoLawliet NezukoLawliet

14-03-2022

Answer:

500 m/s

Explanation:

Wave Speed=Frequency x Wavelength

=50x10

=500

Answer Link

Otras preguntas

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti

Read each verbal expression Then assign a variable and distribute

How far away is the next Earth-like planet in light years? What does this seem unlikely that it won’t be a manned space mission?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why silk is called queen of fiber?

Virginia is 7-years old. georgia is 14 years old. both girls like to write short stories

Billy has 1 gallon of paint. He is going to pour it into a paint tray that measures 10 inches wide, 14 inches long, and 4 cm deep. Which of the following scenar

One of the most damaging problems of the carter administration was its failure to win the release of u.s. hostages from

Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.

Who basically "began" England's religious reformation?