morganwallace52
morganwallace52 morganwallace52
  • 01-02-2017
  • Geography
contestada

When Jesus began his ministry, many of his teachings reflected __________ traditions. A. Muslim B. Greek C. Jewish D. Roman

Respuesta :

Аноним Аноним
  • 01-02-2017
The answer to this question is C) Jewish. Hope I could help!
Answer Link
mccoran
mccoran mccoran
  • 29-04-2021

Answer:

c

Explanation:

Answer Link

Otras preguntas

When a cell undergoes mitosis , what is the result ? OA . four cells created from the combination of two parent cells OB . two genetically identical cells OC .
Find the slope and the y-intercept of the line. -5x-2y=-10
que es el acento ortografico
The diameter of a circle is 16 units. What is the radius of the circle?
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Which group has the greatest number of valence electrons?
What is the value of the expression? [(-4+3) X (4 + 2) – 5] x 3 A. -33 B. -21 C. 15 D. 27 E. 38
Find all solutions to 6x^4+13x^3–71x^2+67x=15​
David scored 5 points less than twice the number scored by Alexis. Together they scored a total of 43 points. How many points did each player score? ​
A man with type a blood married a woman with type B.Their offspring will be AB blood. The pattern of inheritance is called