jamesgiovanni18 jamesgiovanni18

02-08-2017
Geography

contestada

Archaeologists Louis and Mary Leakeysome found some of the oldest human remains in __________ during the 1950s

Respuesta :

Android1639 Android1639

03-08-2017

The Zinjanthropus Skull and Laetoli footprints were found in Tanzania (a country on the Indian Ocean and south of the Horn of Africa)

Answer Link

Otras preguntas

Find the unknown length in this pair of similar triangles.

Can you help me answer this question

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Which of these triangle pairs can be mapped to each other using a reflection and a translation?

Best Buy is offering the same percentage discount on all of their TVs. Suppose one TV is marked down from $650 to $546. Based on that percentage discount, what

Pls help Thank you ❤️

skill is needed to develop group emotion give your logic?????

What is the first step to find the interquartile range of the data set? A. Find the mean of the data set. B. Find the sum of the values in the data set. C. Ord

enzymes. 2. Enzymes depend on their structure to function properly. Which of the following does not alter an enzyme's structure? A. Temperature B. pH likely due

Poverty allevation is neccesary for the sustainable development.How??