shivanshmalhotowjlku shivanshmalhotowjlku
  • 03-12-2017
  • Mathematics
contestada

Need help with question 1

Need help with question 1 class=

Respuesta :

mariyah6
mariyah6 mariyah6
  • 03-12-2017
After 4 hours just do 40-28 which will get you 12 gallons
Answer Link

Otras preguntas

Application of force with movement is called _______________ exercise.
El clima de la costa Guatemalteca es tropical, es decir es ______________________.
Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc
what are the zeros of the polynomial x2+4x-12
What’s the answer to #12? and why
If 5 potatoes together have a mass of 1 kg and 8 pears together have a mass of 1,200 grams, which has the greater mass, potato or pear? explain.
Both Ghandhi and king set which type of mood in their introduction
How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False